ID: 1035024815

View in Genome Browser
Species Human (GRCh38)
Location 7:155818586-155818608
Sequence CCCCTTCCTGTGGCATCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035024802_1035024815 29 Left 1035024802 7:155818534-155818556 CCCAGTTCTTGCCGTGTATACAA No data
Right 1035024815 7:155818586-155818608 CCCCTTCCTGTGGCATCCACTGG No data
1035024801_1035024815 30 Left 1035024801 7:155818533-155818555 CCCCAGTTCTTGCCGTGTATACA No data
Right 1035024815 7:155818586-155818608 CCCCTTCCTGTGGCATCCACTGG No data
1035024803_1035024815 28 Left 1035024803 7:155818535-155818557 CCAGTTCTTGCCGTGTATACAAG No data
Right 1035024815 7:155818586-155818608 CCCCTTCCTGTGGCATCCACTGG No data
1035024807_1035024815 -2 Left 1035024807 7:155818565-155818587 CCAAGAGTGACCCCCTCCTTGCC No data
Right 1035024815 7:155818586-155818608 CCCCTTCCTGTGGCATCCACTGG No data
1035024805_1035024815 18 Left 1035024805 7:155818545-155818567 CCGTGTATACAAGGCAGAACCCA No data
Right 1035024815 7:155818586-155818608 CCCCTTCCTGTGGCATCCACTGG No data
1035024806_1035024815 -1 Left 1035024806 7:155818564-155818586 CCCAAGAGTGACCCCCTCCTTGC No data
Right 1035024815 7:155818586-155818608 CCCCTTCCTGTGGCATCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035024815 Original CRISPR CCCCTTCCTGTGGCATCCAC TGG Intergenic
No off target data available for this crispr