ID: 1035024818

View in Genome Browser
Species Human (GRCh38)
Location 7:155818592-155818614
Sequence CACGATCCAGTGGATGCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035024818_1035024832 30 Left 1035024818 7:155818592-155818614 CCTGTGGCATCCACTGGATCGTG No data
Right 1035024832 7:155818645-155818667 CCAGCAGCCGTTCCTGCCCTGGG No data
1035024818_1035024822 -4 Left 1035024818 7:155818592-155818614 CCTGTGGCATCCACTGGATCGTG No data
Right 1035024822 7:155818611-155818633 CGTGGCCCCGCCCACACTGGAGG No data
1035024818_1035024821 -7 Left 1035024818 7:155818592-155818614 CCTGTGGCATCCACTGGATCGTG No data
Right 1035024821 7:155818608-155818630 GATCGTGGCCCCGCCCACACTGG No data
1035024818_1035024826 5 Left 1035024818 7:155818592-155818614 CCTGTGGCATCCACTGGATCGTG No data
Right 1035024826 7:155818620-155818642 GCCCACACTGGAGGTCAGCCTGG No data
1035024818_1035024830 29 Left 1035024818 7:155818592-155818614 CCTGTGGCATCCACTGGATCGTG No data
Right 1035024830 7:155818644-155818666 TCCAGCAGCCGTTCCTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035024818 Original CRISPR CACGATCCAGTGGATGCCAC AGG (reversed) Intergenic
No off target data available for this crispr