ID: 1035024819

View in Genome Browser
Species Human (GRCh38)
Location 7:155818593-155818615
Sequence CTGTGGCATCCACTGGATCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035024805_1035024819 25 Left 1035024805 7:155818545-155818567 CCGTGTATACAAGGCAGAACCCA No data
Right 1035024819 7:155818593-155818615 CTGTGGCATCCACTGGATCGTGG No data
1035024812_1035024819 -8 Left 1035024812 7:155818578-155818600 CCTCCTTGCCCCTTCCTGTGGCA No data
Right 1035024819 7:155818593-155818615 CTGTGGCATCCACTGGATCGTGG No data
1035024807_1035024819 5 Left 1035024807 7:155818565-155818587 CCAAGAGTGACCCCCTCCTTGCC No data
Right 1035024819 7:155818593-155818615 CTGTGGCATCCACTGGATCGTGG No data
1035024811_1035024819 -7 Left 1035024811 7:155818577-155818599 CCCTCCTTGCCCCTTCCTGTGGC No data
Right 1035024819 7:155818593-155818615 CTGTGGCATCCACTGGATCGTGG No data
1035024809_1035024819 -6 Left 1035024809 7:155818576-155818598 CCCCTCCTTGCCCCTTCCTGTGG No data
Right 1035024819 7:155818593-155818615 CTGTGGCATCCACTGGATCGTGG No data
1035024808_1035024819 -5 Left 1035024808 7:155818575-155818597 CCCCCTCCTTGCCCCTTCCTGTG No data
Right 1035024819 7:155818593-155818615 CTGTGGCATCCACTGGATCGTGG No data
1035024806_1035024819 6 Left 1035024806 7:155818564-155818586 CCCAAGAGTGACCCCCTCCTTGC No data
Right 1035024819 7:155818593-155818615 CTGTGGCATCCACTGGATCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035024819 Original CRISPR CTGTGGCATCCACTGGATCG TGG Intergenic
No off target data available for this crispr