ID: 1035024821

View in Genome Browser
Species Human (GRCh38)
Location 7:155818608-155818630
Sequence GATCGTGGCCCCGCCCACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035024811_1035024821 8 Left 1035024811 7:155818577-155818599 CCCTCCTTGCCCCTTCCTGTGGC No data
Right 1035024821 7:155818608-155818630 GATCGTGGCCCCGCCCACACTGG No data
1035024809_1035024821 9 Left 1035024809 7:155818576-155818598 CCCCTCCTTGCCCCTTCCTGTGG No data
Right 1035024821 7:155818608-155818630 GATCGTGGCCCCGCCCACACTGG No data
1035024808_1035024821 10 Left 1035024808 7:155818575-155818597 CCCCCTCCTTGCCCCTTCCTGTG No data
Right 1035024821 7:155818608-155818630 GATCGTGGCCCCGCCCACACTGG No data
1035024806_1035024821 21 Left 1035024806 7:155818564-155818586 CCCAAGAGTGACCCCCTCCTTGC No data
Right 1035024821 7:155818608-155818630 GATCGTGGCCCCGCCCACACTGG No data
1035024814_1035024821 -1 Left 1035024814 7:155818586-155818608 CCCCTTCCTGTGGCATCCACTGG No data
Right 1035024821 7:155818608-155818630 GATCGTGGCCCCGCCCACACTGG No data
1035024817_1035024821 -3 Left 1035024817 7:155818588-155818610 CCTTCCTGTGGCATCCACTGGAT No data
Right 1035024821 7:155818608-155818630 GATCGTGGCCCCGCCCACACTGG No data
1035024807_1035024821 20 Left 1035024807 7:155818565-155818587 CCAAGAGTGACCCCCTCCTTGCC No data
Right 1035024821 7:155818608-155818630 GATCGTGGCCCCGCCCACACTGG No data
1035024816_1035024821 -2 Left 1035024816 7:155818587-155818609 CCCTTCCTGTGGCATCCACTGGA No data
Right 1035024821 7:155818608-155818630 GATCGTGGCCCCGCCCACACTGG No data
1035024812_1035024821 7 Left 1035024812 7:155818578-155818600 CCTCCTTGCCCCTTCCTGTGGCA No data
Right 1035024821 7:155818608-155818630 GATCGTGGCCCCGCCCACACTGG No data
1035024813_1035024821 4 Left 1035024813 7:155818581-155818603 CCTTGCCCCTTCCTGTGGCATCC No data
Right 1035024821 7:155818608-155818630 GATCGTGGCCCCGCCCACACTGG No data
1035024818_1035024821 -7 Left 1035024818 7:155818592-155818614 CCTGTGGCATCCACTGGATCGTG No data
Right 1035024821 7:155818608-155818630 GATCGTGGCCCCGCCCACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035024821 Original CRISPR GATCGTGGCCCCGCCCACAC TGG Intergenic
No off target data available for this crispr