ID: 1035025071

View in Genome Browser
Species Human (GRCh38)
Location 7:155819908-155819930
Sequence TTGGGTAAGGGGAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035025059_1035025071 15 Left 1035025059 7:155819870-155819892 CCATGTGGCGCTCAGCACTTTTC No data
Right 1035025071 7:155819908-155819930 TTGGGTAAGGGGAGGGAGGAGGG No data
1035025058_1035025071 25 Left 1035025058 7:155819860-155819882 CCGGAAGCTTCCATGTGGCGCTC No data
Right 1035025071 7:155819908-155819930 TTGGGTAAGGGGAGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035025071 Original CRISPR TTGGGTAAGGGGAGGGAGGA GGG Intergenic
No off target data available for this crispr