ID: 1035025620

View in Genome Browser
Species Human (GRCh38)
Location 7:155823460-155823482
Sequence CGCTGCTCGGGAGGGGCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035025620_1035025632 10 Left 1035025620 7:155823460-155823482 CCCCCTGCCCCTCCCGAGCAGCG No data
Right 1035025632 7:155823493-155823515 GCGACCGTGAAGGCGTCACGTGG No data
1035025620_1035025635 22 Left 1035025620 7:155823460-155823482 CCCCCTGCCCCTCCCGAGCAGCG No data
Right 1035025635 7:155823505-155823527 GCGTCACGTGGGAATCCTGATGG No data
1035025620_1035025633 11 Left 1035025620 7:155823460-155823482 CCCCCTGCCCCTCCCGAGCAGCG No data
Right 1035025633 7:155823494-155823516 CGACCGTGAAGGCGTCACGTGGG No data
1035025620_1035025636 23 Left 1035025620 7:155823460-155823482 CCCCCTGCCCCTCCCGAGCAGCG No data
Right 1035025636 7:155823506-155823528 CGTCACGTGGGAATCCTGATGGG No data
1035025620_1035025631 0 Left 1035025620 7:155823460-155823482 CCCCCTGCCCCTCCCGAGCAGCG No data
Right 1035025631 7:155823483-155823505 AATGGGATGAGCGACCGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035025620 Original CRISPR CGCTGCTCGGGAGGGGCAGG GGG (reversed) Intergenic
No off target data available for this crispr