ID: 1035028993

View in Genome Browser
Species Human (GRCh38)
Location 7:155845074-155845096
Sequence CTGTGACCACAGATAGAAAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035028993_1035028996 -10 Left 1035028993 7:155845074-155845096 CCGATTTCTATCTGTGGTCACAG No data
Right 1035028996 7:155845087-155845109 GTGGTCACAGAGAGAGAGAGGGG No data
1035028993_1035028998 11 Left 1035028993 7:155845074-155845096 CCGATTTCTATCTGTGGTCACAG No data
Right 1035028998 7:155845108-155845130 GGTCCAGGTTTTCCAGTTTTTGG No data
1035028993_1035028999 12 Left 1035028993 7:155845074-155845096 CCGATTTCTATCTGTGGTCACAG No data
Right 1035028999 7:155845109-155845131 GTCCAGGTTTTCCAGTTTTTGGG No data
1035028993_1035028997 -4 Left 1035028993 7:155845074-155845096 CCGATTTCTATCTGTGGTCACAG No data
Right 1035028997 7:155845093-155845115 ACAGAGAGAGAGAGGGGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035028993 Original CRISPR CTGTGACCACAGATAGAAAT CGG (reversed) Intergenic
No off target data available for this crispr