ID: 1035029942

View in Genome Browser
Species Human (GRCh38)
Location 7:155850247-155850269
Sequence TCAGAGAGATTTCTCCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035029942_1035029944 -7 Left 1035029942 7:155850247-155850269 CCTGCAGGGAGAAATCTCTCTGA No data
Right 1035029944 7:155850263-155850285 TCTCTGAGAGGATCCCTCCTCGG No data
1035029942_1035029956 26 Left 1035029942 7:155850247-155850269 CCTGCAGGGAGAAATCTCTCTGA No data
Right 1035029956 7:155850296-155850318 CTCCCCATGGGGGAATGGGGTGG No data
1035029942_1035029951 16 Left 1035029942 7:155850247-155850269 CCTGCAGGGAGAAATCTCTCTGA No data
Right 1035029951 7:155850286-155850308 CTCCAAGCTGCTCCCCATGGGGG No data
1035029942_1035029954 22 Left 1035029942 7:155850247-155850269 CCTGCAGGGAGAAATCTCTCTGA No data
Right 1035029954 7:155850292-155850314 GCTGCTCCCCATGGGGGAATGGG No data
1035029942_1035029948 13 Left 1035029942 7:155850247-155850269 CCTGCAGGGAGAAATCTCTCTGA No data
Right 1035029948 7:155850283-155850305 CGGCTCCAAGCTGCTCCCCATGG No data
1035029942_1035029949 14 Left 1035029942 7:155850247-155850269 CCTGCAGGGAGAAATCTCTCTGA No data
Right 1035029949 7:155850284-155850306 GGCTCCAAGCTGCTCCCCATGGG No data
1035029942_1035029953 21 Left 1035029942 7:155850247-155850269 CCTGCAGGGAGAAATCTCTCTGA No data
Right 1035029953 7:155850291-155850313 AGCTGCTCCCCATGGGGGAATGG No data
1035029942_1035029950 15 Left 1035029942 7:155850247-155850269 CCTGCAGGGAGAAATCTCTCTGA No data
Right 1035029950 7:155850285-155850307 GCTCCAAGCTGCTCCCCATGGGG No data
1035029942_1035029955 23 Left 1035029942 7:155850247-155850269 CCTGCAGGGAGAAATCTCTCTGA No data
Right 1035029955 7:155850293-155850315 CTGCTCCCCATGGGGGAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035029942 Original CRISPR TCAGAGAGATTTCTCCCTGC AGG (reversed) Intergenic
No off target data available for this crispr