ID: 1035029944

View in Genome Browser
Species Human (GRCh38)
Location 7:155850263-155850285
Sequence TCTCTGAGAGGATCCCTCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035029941_1035029944 -6 Left 1035029941 7:155850246-155850268 CCCTGCAGGGAGAAATCTCTCTG No data
Right 1035029944 7:155850263-155850285 TCTCTGAGAGGATCCCTCCTCGG No data
1035029935_1035029944 18 Left 1035029935 7:155850222-155850244 CCACCAGGATCCTGCTCACCTTT No data
Right 1035029944 7:155850263-155850285 TCTCTGAGAGGATCCCTCCTCGG No data
1035029936_1035029944 15 Left 1035029936 7:155850225-155850247 CCAGGATCCTGCTCACCTTTTCC No data
Right 1035029944 7:155850263-155850285 TCTCTGAGAGGATCCCTCCTCGG No data
1035029937_1035029944 8 Left 1035029937 7:155850232-155850254 CCTGCTCACCTTTTCCCTGCAGG No data
Right 1035029944 7:155850263-155850285 TCTCTGAGAGGATCCCTCCTCGG No data
1035029942_1035029944 -7 Left 1035029942 7:155850247-155850269 CCTGCAGGGAGAAATCTCTCTGA No data
Right 1035029944 7:155850263-155850285 TCTCTGAGAGGATCCCTCCTCGG No data
1035029940_1035029944 0 Left 1035029940 7:155850240-155850262 CCTTTTCCCTGCAGGGAGAAATC No data
Right 1035029944 7:155850263-155850285 TCTCTGAGAGGATCCCTCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035029944 Original CRISPR TCTCTGAGAGGATCCCTCCT CGG Intergenic
No off target data available for this crispr