ID: 1035029946

View in Genome Browser
Species Human (GRCh38)
Location 7:155850277-155850299
Sequence GGAGCAGCTTGGAGCCGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035029946_1035029954 -8 Left 1035029946 7:155850277-155850299 CCTCCTCGGCTCCAAGCTGCTCC No data
Right 1035029954 7:155850292-155850314 GCTGCTCCCCATGGGGGAATGGG No data
1035029946_1035029956 -4 Left 1035029946 7:155850277-155850299 CCTCCTCGGCTCCAAGCTGCTCC No data
Right 1035029956 7:155850296-155850318 CTCCCCATGGGGGAATGGGGTGG No data
1035029946_1035029960 9 Left 1035029946 7:155850277-155850299 CCTCCTCGGCTCCAAGCTGCTCC No data
Right 1035029960 7:155850309-155850331 AATGGGGTGGCAGAGCAGAGTGG No data
1035029946_1035029955 -7 Left 1035029946 7:155850277-155850299 CCTCCTCGGCTCCAAGCTGCTCC No data
Right 1035029955 7:155850293-155850315 CTGCTCCCCATGGGGGAATGGGG No data
1035029946_1035029953 -9 Left 1035029946 7:155850277-155850299 CCTCCTCGGCTCCAAGCTGCTCC No data
Right 1035029953 7:155850291-155850313 AGCTGCTCCCCATGGGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035029946 Original CRISPR GGAGCAGCTTGGAGCCGAGG AGG (reversed) Intergenic
No off target data available for this crispr