ID: 1035029951

View in Genome Browser
Species Human (GRCh38)
Location 7:155850286-155850308
Sequence CTCCAAGCTGCTCCCCATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035029940_1035029951 23 Left 1035029940 7:155850240-155850262 CCTTTTCCCTGCAGGGAGAAATC No data
Right 1035029951 7:155850286-155850308 CTCCAAGCTGCTCCCCATGGGGG No data
1035029941_1035029951 17 Left 1035029941 7:155850246-155850268 CCCTGCAGGGAGAAATCTCTCTG No data
Right 1035029951 7:155850286-155850308 CTCCAAGCTGCTCCCCATGGGGG No data
1035029942_1035029951 16 Left 1035029942 7:155850247-155850269 CCTGCAGGGAGAAATCTCTCTGA No data
Right 1035029951 7:155850286-155850308 CTCCAAGCTGCTCCCCATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035029951 Original CRISPR CTCCAAGCTGCTCCCCATGG GGG Intergenic
No off target data available for this crispr