ID: 1035029955

View in Genome Browser
Species Human (GRCh38)
Location 7:155850293-155850315
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035029946_1035029955 -7 Left 1035029946 7:155850277-155850299 CCTCCTCGGCTCCAAGCTGCTCC No data
Right 1035029955 7:155850293-155850315 CTGCTCCCCATGGGGGAATGGGG No data
1035029942_1035029955 23 Left 1035029942 7:155850247-155850269 CCTGCAGGGAGAAATCTCTCTGA No data
Right 1035029955 7:155850293-155850315 CTGCTCCCCATGGGGGAATGGGG No data
1035029945_1035029955 -6 Left 1035029945 7:155850276-155850298 CCCTCCTCGGCTCCAAGCTGCTC No data
Right 1035029955 7:155850293-155850315 CTGCTCCCCATGGGGGAATGGGG No data
1035029947_1035029955 -10 Left 1035029947 7:155850280-155850302 CCTCGGCTCCAAGCTGCTCCCCA No data
Right 1035029955 7:155850293-155850315 CTGCTCCCCATGGGGGAATGGGG No data
1035029941_1035029955 24 Left 1035029941 7:155850246-155850268 CCCTGCAGGGAGAAATCTCTCTG No data
Right 1035029955 7:155850293-155850315 CTGCTCCCCATGGGGGAATGGGG No data
1035029940_1035029955 30 Left 1035029940 7:155850240-155850262 CCTTTTCCCTGCAGGGAGAAATC No data
Right 1035029955 7:155850293-155850315 CTGCTCCCCATGGGGGAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035029955 Original CRISPR CTGCTCCCCATGGGGGAATG GGG Intergenic
No off target data available for this crispr