ID: 1035029956

View in Genome Browser
Species Human (GRCh38)
Location 7:155850296-155850318
Sequence CTCCCCATGGGGGAATGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035029946_1035029956 -4 Left 1035029946 7:155850277-155850299 CCTCCTCGGCTCCAAGCTGCTCC No data
Right 1035029956 7:155850296-155850318 CTCCCCATGGGGGAATGGGGTGG No data
1035029941_1035029956 27 Left 1035029941 7:155850246-155850268 CCCTGCAGGGAGAAATCTCTCTG No data
Right 1035029956 7:155850296-155850318 CTCCCCATGGGGGAATGGGGTGG No data
1035029942_1035029956 26 Left 1035029942 7:155850247-155850269 CCTGCAGGGAGAAATCTCTCTGA No data
Right 1035029956 7:155850296-155850318 CTCCCCATGGGGGAATGGGGTGG No data
1035029947_1035029956 -7 Left 1035029947 7:155850280-155850302 CCTCGGCTCCAAGCTGCTCCCCA No data
Right 1035029956 7:155850296-155850318 CTCCCCATGGGGGAATGGGGTGG No data
1035029945_1035029956 -3 Left 1035029945 7:155850276-155850298 CCCTCCTCGGCTCCAAGCTGCTC No data
Right 1035029956 7:155850296-155850318 CTCCCCATGGGGGAATGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035029956 Original CRISPR CTCCCCATGGGGGAATGGGG TGG Intergenic
No off target data available for this crispr