ID: 1035029960

View in Genome Browser
Species Human (GRCh38)
Location 7:155850309-155850331
Sequence AATGGGGTGGCAGAGCAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035029945_1035029960 10 Left 1035029945 7:155850276-155850298 CCCTCCTCGGCTCCAAGCTGCTC No data
Right 1035029960 7:155850309-155850331 AATGGGGTGGCAGAGCAGAGTGG No data
1035029946_1035029960 9 Left 1035029946 7:155850277-155850299 CCTCCTCGGCTCCAAGCTGCTCC No data
Right 1035029960 7:155850309-155850331 AATGGGGTGGCAGAGCAGAGTGG No data
1035029947_1035029960 6 Left 1035029947 7:155850280-155850302 CCTCGGCTCCAAGCTGCTCCCCA No data
Right 1035029960 7:155850309-155850331 AATGGGGTGGCAGAGCAGAGTGG No data
1035029952_1035029960 -2 Left 1035029952 7:155850288-155850310 CCAAGCTGCTCCCCATGGGGGAA No data
Right 1035029960 7:155850309-155850331 AATGGGGTGGCAGAGCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035029960 Original CRISPR AATGGGGTGGCAGAGCAGAG TGG Intergenic
No off target data available for this crispr