ID: 1035032161

View in Genome Browser
Species Human (GRCh38)
Location 7:155868442-155868464
Sequence CTGTTTAGCCAGAAGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035032157_1035032161 15 Left 1035032157 7:155868404-155868426 CCTGAGGCTGGCATATTGTCACC No data
Right 1035032161 7:155868442-155868464 CTGTTTAGCCAGAAGGAAGAGGG No data
1035032158_1035032161 -6 Left 1035032158 7:155868425-155868447 CCTGAACAAGTCAAGTTCTGTTT No data
Right 1035032161 7:155868442-155868464 CTGTTTAGCCAGAAGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035032161 Original CRISPR CTGTTTAGCCAGAAGGAAGA GGG Intergenic
No off target data available for this crispr