ID: 1035034202

View in Genome Browser
Species Human (GRCh38)
Location 7:155884705-155884727
Sequence TATCAAGAGGGGCTGTCCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035034198_1035034202 18 Left 1035034198 7:155884664-155884686 CCAGAGACACTTTCAACAAGGAA No data
Right 1035034202 7:155884705-155884727 TATCAAGAGGGGCTGTCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035034202 Original CRISPR TATCAAGAGGGGCTGTCCTA AGG Intergenic
No off target data available for this crispr