ID: 1035038801

View in Genome Browser
Species Human (GRCh38)
Location 7:155912772-155912794
Sequence TACTGTGTATGATGAGCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035038799_1035038801 23 Left 1035038799 7:155912726-155912748 CCTAGGCACTGAGGTTCAGCTGC No data
Right 1035038801 7:155912772-155912794 TACTGTGTATGATGAGCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035038801 Original CRISPR TACTGTGTATGATGAGCATG TGG Intergenic
No off target data available for this crispr