ID: 1035040583

View in Genome Browser
Species Human (GRCh38)
Location 7:155923988-155924010
Sequence TGGGATCCACCAGACGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035040583_1035040589 6 Left 1035040583 7:155923988-155924010 CCATGCTCGTCTGGTGGATCCCA No data
Right 1035040589 7:155924017-155924039 AGGCAGCCTCTAAGAAGAGAAGG No data
1035040583_1035040590 7 Left 1035040583 7:155923988-155924010 CCATGCTCGTCTGGTGGATCCCA No data
Right 1035040590 7:155924018-155924040 GGCAGCCTCTAAGAAGAGAAGGG No data
1035040583_1035040592 15 Left 1035040583 7:155923988-155924010 CCATGCTCGTCTGGTGGATCCCA No data
Right 1035040592 7:155924026-155924048 CTAAGAAGAGAAGGGCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035040583 Original CRISPR TGGGATCCACCAGACGAGCA TGG (reversed) Intergenic
No off target data available for this crispr