ID: 1035040589

View in Genome Browser
Species Human (GRCh38)
Location 7:155924017-155924039
Sequence AGGCAGCCTCTAAGAAGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035040583_1035040589 6 Left 1035040583 7:155923988-155924010 CCATGCTCGTCTGGTGGATCCCA No data
Right 1035040589 7:155924017-155924039 AGGCAGCCTCTAAGAAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035040589 Original CRISPR AGGCAGCCTCTAAGAAGAGA AGG Intergenic
No off target data available for this crispr