ID: 1035040592

View in Genome Browser
Species Human (GRCh38)
Location 7:155924026-155924048
Sequence CTAAGAAGAGAAGGGCCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035040583_1035040592 15 Left 1035040583 7:155923988-155924010 CCATGCTCGTCTGGTGGATCCCA No data
Right 1035040592 7:155924026-155924048 CTAAGAAGAGAAGGGCCCTGAGG No data
1035040585_1035040592 -4 Left 1035040585 7:155924007-155924029 CCCAAGTCCCAGGCAGCCTCTAA No data
Right 1035040592 7:155924026-155924048 CTAAGAAGAGAAGGGCCCTGAGG No data
1035040586_1035040592 -5 Left 1035040586 7:155924008-155924030 CCAAGTCCCAGGCAGCCTCTAAG No data
Right 1035040592 7:155924026-155924048 CTAAGAAGAGAAGGGCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035040592 Original CRISPR CTAAGAAGAGAAGGGCCCTG AGG Intergenic
No off target data available for this crispr