ID: 1035044619

View in Genome Browser
Species Human (GRCh38)
Location 7:155955465-155955487
Sequence TTTCCTTGTGGACCACTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035044617_1035044619 -2 Left 1035044617 7:155955444-155955466 CCTGGTTTTGGAGAGATGCTGTT No data
Right 1035044619 7:155955465-155955487 TTTCCTTGTGGACCACTAGCTGG No data
1035044616_1035044619 -1 Left 1035044616 7:155955443-155955465 CCCTGGTTTTGGAGAGATGCTGT No data
Right 1035044619 7:155955465-155955487 TTTCCTTGTGGACCACTAGCTGG No data
1035044613_1035044619 12 Left 1035044613 7:155955430-155955452 CCTGCTGCCGTGTCCCTGGTTTT No data
Right 1035044619 7:155955465-155955487 TTTCCTTGTGGACCACTAGCTGG No data
1035044615_1035044619 5 Left 1035044615 7:155955437-155955459 CCGTGTCCCTGGTTTTGGAGAGA No data
Right 1035044619 7:155955465-155955487 TTTCCTTGTGGACCACTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035044619 Original CRISPR TTTCCTTGTGGACCACTAGC TGG Intergenic
No off target data available for this crispr