ID: 1035044715

View in Genome Browser
Species Human (GRCh38)
Location 7:155956101-155956123
Sequence CCCACCATGGAGAGCAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035044715_1035044721 -8 Left 1035044715 7:155956101-155956123 CCCTCCCTGCTCTCCATGGTGGG No data
Right 1035044721 7:155956116-155956138 ATGGTGGGCTGTCTCCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035044715 Original CRISPR CCCACCATGGAGAGCAGGGA GGG (reversed) Intergenic
No off target data available for this crispr