ID: 1035045167

View in Genome Browser
Species Human (GRCh38)
Location 7:155960936-155960958
Sequence CCTGAAGGCCAGCTCAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035045167_1035045175 14 Left 1035045167 7:155960936-155960958 CCTGCCCTGAGCTGGCCTTCAGG No data
Right 1035045175 7:155960973-155960995 TTTCTGCGCACTCTGCACTCTGG No data
1035045167_1035045172 -9 Left 1035045167 7:155960936-155960958 CCTGCCCTGAGCTGGCCTTCAGG No data
Right 1035045172 7:155960950-155960972 GCCTTCAGGAAGGTGAATTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035045167 Original CRISPR CCTGAAGGCCAGCTCAGGGC AGG (reversed) Intergenic
No off target data available for this crispr