ID: 1035046725

View in Genome Browser
Species Human (GRCh38)
Location 7:155972737-155972759
Sequence CAGGGAAGAGACAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035046713_1035046725 3 Left 1035046713 7:155972711-155972733 CCCAGAAGGCTGACCCTGCGAGG No data
Right 1035046725 7:155972737-155972759 CAGGGAAGAGACAGGGAGGAAGG No data
1035046718_1035046725 -10 Left 1035046718 7:155972724-155972746 CCCTGCGAGGACCCAGGGAAGAG No data
Right 1035046725 7:155972737-155972759 CAGGGAAGAGACAGGGAGGAAGG No data
1035046715_1035046725 2 Left 1035046715 7:155972712-155972734 CCAGAAGGCTGACCCTGCGAGGA No data
Right 1035046725 7:155972737-155972759 CAGGGAAGAGACAGGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035046725 Original CRISPR CAGGGAAGAGACAGGGAGGA AGG Intergenic
No off target data available for this crispr