ID: 1035047018

View in Genome Browser
Species Human (GRCh38)
Location 7:155974294-155974316
Sequence CAGCCTGCAGACCCAGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035047018_1035047021 25 Left 1035047018 7:155974294-155974316 CCCAGGGCTGGGTCTGCAGGCTG No data
Right 1035047021 7:155974342-155974364 ATTTACAGAGATTCTCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035047018 Original CRISPR CAGCCTGCAGACCCAGCCCT GGG (reversed) Intergenic
No off target data available for this crispr