ID: 1035055619

View in Genome Browser
Species Human (GRCh38)
Location 7:156034015-156034037
Sequence AGGTAATTCTAGATGGAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035055615_1035055619 -6 Left 1035055615 7:156033998-156034020 CCTTACACTACACCCAAAGGTAA No data
Right 1035055619 7:156034015-156034037 AGGTAATTCTAGATGGAGTAAGG No data
1035055613_1035055619 6 Left 1035055613 7:156033986-156034008 CCTCAACTCTTACCTTACACTAC No data
Right 1035055619 7:156034015-156034037 AGGTAATTCTAGATGGAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035055619 Original CRISPR AGGTAATTCTAGATGGAGTA AGG Intergenic
No off target data available for this crispr