ID: 1035057671

View in Genome Browser
Species Human (GRCh38)
Location 7:156046770-156046792
Sequence CACCTGCATTTCCCCACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035057671_1035057681 12 Left 1035057671 7:156046770-156046792 CCAGCTGTGGGGAAATGCAGGTG No data
Right 1035057681 7:156046805-156046827 TGGTGACAGCATGTGGCCCTGGG No data
1035057671_1035057680 11 Left 1035057671 7:156046770-156046792 CCAGCTGTGGGGAAATGCAGGTG No data
Right 1035057680 7:156046804-156046826 GTGGTGACAGCATGTGGCCCTGG No data
1035057671_1035057689 29 Left 1035057671 7:156046770-156046792 CCAGCTGTGGGGAAATGCAGGTG No data
Right 1035057689 7:156046822-156046844 CCTGGGGCTGTGGGTGAGGGCGG No data
1035057671_1035057684 20 Left 1035057671 7:156046770-156046792 CCAGCTGTGGGGAAATGCAGGTG No data
Right 1035057684 7:156046813-156046835 GCATGTGGCCCTGGGGCTGTGGG No data
1035057671_1035057685 25 Left 1035057671 7:156046770-156046792 CCAGCTGTGGGGAAATGCAGGTG No data
Right 1035057685 7:156046818-156046840 TGGCCCTGGGGCTGTGGGTGAGG No data
1035057671_1035057682 13 Left 1035057671 7:156046770-156046792 CCAGCTGTGGGGAAATGCAGGTG No data
Right 1035057682 7:156046806-156046828 GGTGACAGCATGTGGCCCTGGGG No data
1035057671_1035057686 26 Left 1035057671 7:156046770-156046792 CCAGCTGTGGGGAAATGCAGGTG No data
Right 1035057686 7:156046819-156046841 GGCCCTGGGGCTGTGGGTGAGGG No data
1035057671_1035057683 19 Left 1035057671 7:156046770-156046792 CCAGCTGTGGGGAAATGCAGGTG No data
Right 1035057683 7:156046812-156046834 AGCATGTGGCCCTGGGGCTGTGG No data
1035057671_1035057676 -8 Left 1035057671 7:156046770-156046792 CCAGCTGTGGGGAAATGCAGGTG No data
Right 1035057676 7:156046785-156046807 TGCAGGTGGACTCCCAGGGGTGG No data
1035057671_1035057679 5 Left 1035057671 7:156046770-156046792 CCAGCTGTGGGGAAATGCAGGTG No data
Right 1035057679 7:156046798-156046820 CCAGGGGTGGTGACAGCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035057671 Original CRISPR CACCTGCATTTCCCCACAGC TGG (reversed) Intergenic
No off target data available for this crispr