ID: 1035058959

View in Genome Browser
Species Human (GRCh38)
Location 7:156055201-156055223
Sequence ATGTTGACACAGGTGGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035058959_1035058971 26 Left 1035058959 7:156055201-156055223 CCCACCCCCACCTGTGTCAACAT No data
Right 1035058971 7:156055250-156055272 GTGCCCCAGCTCCTGCCTCCAGG No data
1035058959_1035058968 1 Left 1035058959 7:156055201-156055223 CCCACCCCCACCTGTGTCAACAT No data
Right 1035058968 7:156055225-156055247 GCCTTTCTGGCCAGTTGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035058959 Original CRISPR ATGTTGACACAGGTGGGGGT GGG (reversed) Intergenic
No off target data available for this crispr