ID: 1035061101

View in Genome Browser
Species Human (GRCh38)
Location 7:156070298-156070320
Sequence CTGCTTCGTTCTGGCCATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035061096_1035061101 -9 Left 1035061096 7:156070284-156070306 CCACCTTCTTCCACCTGCTTCGT No data
Right 1035061101 7:156070298-156070320 CTGCTTCGTTCTGGCCATGCTGG No data
1035061094_1035061101 1 Left 1035061094 7:156070274-156070296 CCGGCTTCTCCCACCTTCTTCCA No data
Right 1035061101 7:156070298-156070320 CTGCTTCGTTCTGGCCATGCTGG No data
1035061093_1035061101 9 Left 1035061093 7:156070266-156070288 CCAGCAGGCCGGCTTCTCCCACC No data
Right 1035061101 7:156070298-156070320 CTGCTTCGTTCTGGCCATGCTGG No data
1035061091_1035061101 18 Left 1035061091 7:156070257-156070279 CCAGAAGACCCAGCAGGCCGGCT No data
Right 1035061101 7:156070298-156070320 CTGCTTCGTTCTGGCCATGCTGG No data
1035061095_1035061101 -8 Left 1035061095 7:156070283-156070305 CCCACCTTCTTCCACCTGCTTCG No data
Right 1035061101 7:156070298-156070320 CTGCTTCGTTCTGGCCATGCTGG No data
1035061092_1035061101 10 Left 1035061092 7:156070265-156070287 CCCAGCAGGCCGGCTTCTCCCAC No data
Right 1035061101 7:156070298-156070320 CTGCTTCGTTCTGGCCATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035061101 Original CRISPR CTGCTTCGTTCTGGCCATGC TGG Intergenic
No off target data available for this crispr