ID: 1035061798

View in Genome Browser
Species Human (GRCh38)
Location 7:156074928-156074950
Sequence CGGGGAAAGTCCACGTTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035061798_1035061811 25 Left 1035061798 7:156074928-156074950 CCAGGCAACGTGGACTTTCCCCG No data
Right 1035061811 7:156074976-156074998 TCAGCCCTGATGGAGGCGAAAGG No data
1035061798_1035061800 -6 Left 1035061798 7:156074928-156074950 CCAGGCAACGTGGACTTTCCCCG No data
Right 1035061800 7:156074945-156074967 TCCCCGTGGTCCTCAATCAGTGG No data
1035061798_1035061810 18 Left 1035061798 7:156074928-156074950 CCAGGCAACGTGGACTTTCCCCG No data
Right 1035061810 7:156074969-156074991 GGGAGTTTCAGCCCTGATGGAGG No data
1035061798_1035061812 26 Left 1035061798 7:156074928-156074950 CCAGGCAACGTGGACTTTCCCCG No data
Right 1035061812 7:156074977-156074999 CAGCCCTGATGGAGGCGAAAGGG No data
1035061798_1035061802 -5 Left 1035061798 7:156074928-156074950 CCAGGCAACGTGGACTTTCCCCG No data
Right 1035061802 7:156074946-156074968 CCCCGTGGTCCTCAATCAGTGGG No data
1035061798_1035061804 -4 Left 1035061798 7:156074928-156074950 CCAGGCAACGTGGACTTTCCCCG No data
Right 1035061804 7:156074947-156074969 CCCGTGGTCCTCAATCAGTGGGG No data
1035061798_1035061809 15 Left 1035061798 7:156074928-156074950 CCAGGCAACGTGGACTTTCCCCG No data
Right 1035061809 7:156074966-156074988 GGGGGGAGTTTCAGCCCTGATGG No data
1035061798_1035061806 -3 Left 1035061798 7:156074928-156074950 CCAGGCAACGTGGACTTTCCCCG No data
Right 1035061806 7:156074948-156074970 CCGTGGTCCTCAATCAGTGGGGG No data
1035061798_1035061807 -2 Left 1035061798 7:156074928-156074950 CCAGGCAACGTGGACTTTCCCCG No data
Right 1035061807 7:156074949-156074971 CGTGGTCCTCAATCAGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035061798 Original CRISPR CGGGGAAAGTCCACGTTGCC TGG (reversed) Intergenic
No off target data available for this crispr