ID: 1035061805

View in Genome Browser
Species Human (GRCh38)
Location 7:156074948-156074970
Sequence CCCCCACTGATTGAGGACCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035061805_1035061811 5 Left 1035061805 7:156074948-156074970 CCGTGGTCCTCAATCAGTGGGGG No data
Right 1035061811 7:156074976-156074998 TCAGCCCTGATGGAGGCGAAAGG No data
1035061805_1035061810 -2 Left 1035061805 7:156074948-156074970 CCGTGGTCCTCAATCAGTGGGGG No data
Right 1035061810 7:156074969-156074991 GGGAGTTTCAGCCCTGATGGAGG No data
1035061805_1035061809 -5 Left 1035061805 7:156074948-156074970 CCGTGGTCCTCAATCAGTGGGGG No data
Right 1035061809 7:156074966-156074988 GGGGGGAGTTTCAGCCCTGATGG No data
1035061805_1035061812 6 Left 1035061805 7:156074948-156074970 CCGTGGTCCTCAATCAGTGGGGG No data
Right 1035061812 7:156074977-156074999 CAGCCCTGATGGAGGCGAAAGGG No data
1035061805_1035061815 12 Left 1035061805 7:156074948-156074970 CCGTGGTCCTCAATCAGTGGGGG No data
Right 1035061815 7:156074983-156075005 TGATGGAGGCGAAAGGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035061805 Original CRISPR CCCCCACTGATTGAGGACCA CGG (reversed) Intergenic
No off target data available for this crispr