ID: 1035061808

View in Genome Browser
Species Human (GRCh38)
Location 7:156074955-156074977
Sequence GAAACTCCCCCCACTGATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035061808_1035061812 -1 Left 1035061808 7:156074955-156074977 CCTCAATCAGTGGGGGGAGTTTC No data
Right 1035061812 7:156074977-156074999 CAGCCCTGATGGAGGCGAAAGGG No data
1035061808_1035061815 5 Left 1035061808 7:156074955-156074977 CCTCAATCAGTGGGGGGAGTTTC No data
Right 1035061815 7:156074983-156075005 TGATGGAGGCGAAAGGGAGCAGG No data
1035061808_1035061810 -9 Left 1035061808 7:156074955-156074977 CCTCAATCAGTGGGGGGAGTTTC No data
Right 1035061810 7:156074969-156074991 GGGAGTTTCAGCCCTGATGGAGG No data
1035061808_1035061811 -2 Left 1035061808 7:156074955-156074977 CCTCAATCAGTGGGGGGAGTTTC No data
Right 1035061811 7:156074976-156074998 TCAGCCCTGATGGAGGCGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035061808 Original CRISPR GAAACTCCCCCCACTGATTG AGG (reversed) Intergenic
No off target data available for this crispr