ID: 1035061810

View in Genome Browser
Species Human (GRCh38)
Location 7:156074969-156074991
Sequence GGGAGTTTCAGCCCTGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035061808_1035061810 -9 Left 1035061808 7:156074955-156074977 CCTCAATCAGTGGGGGGAGTTTC No data
Right 1035061810 7:156074969-156074991 GGGAGTTTCAGCCCTGATGGAGG No data
1035061798_1035061810 18 Left 1035061798 7:156074928-156074950 CCAGGCAACGTGGACTTTCCCCG No data
Right 1035061810 7:156074969-156074991 GGGAGTTTCAGCCCTGATGGAGG No data
1035061797_1035061810 24 Left 1035061797 7:156074922-156074944 CCTTCTCCAGGCAACGTGGACTT No data
Right 1035061810 7:156074969-156074991 GGGAGTTTCAGCCCTGATGGAGG No data
1035061803_1035061810 -1 Left 1035061803 7:156074947-156074969 CCCGTGGTCCTCAATCAGTGGGG No data
Right 1035061810 7:156074969-156074991 GGGAGTTTCAGCCCTGATGGAGG No data
1035061805_1035061810 -2 Left 1035061805 7:156074948-156074970 CCGTGGTCCTCAATCAGTGGGGG No data
Right 1035061810 7:156074969-156074991 GGGAGTTTCAGCCCTGATGGAGG No data
1035061801_1035061810 0 Left 1035061801 7:156074946-156074968 CCCCGTGGTCCTCAATCAGTGGG No data
Right 1035061810 7:156074969-156074991 GGGAGTTTCAGCCCTGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035061810 Original CRISPR GGGAGTTTCAGCCCTGATGG AGG Intergenic
No off target data available for this crispr