ID: 1035061812

View in Genome Browser
Species Human (GRCh38)
Location 7:156074977-156074999
Sequence CAGCCCTGATGGAGGCGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035061808_1035061812 -1 Left 1035061808 7:156074955-156074977 CCTCAATCAGTGGGGGGAGTTTC No data
Right 1035061812 7:156074977-156074999 CAGCCCTGATGGAGGCGAAAGGG No data
1035061801_1035061812 8 Left 1035061801 7:156074946-156074968 CCCCGTGGTCCTCAATCAGTGGG No data
Right 1035061812 7:156074977-156074999 CAGCCCTGATGGAGGCGAAAGGG No data
1035061803_1035061812 7 Left 1035061803 7:156074947-156074969 CCCGTGGTCCTCAATCAGTGGGG No data
Right 1035061812 7:156074977-156074999 CAGCCCTGATGGAGGCGAAAGGG No data
1035061798_1035061812 26 Left 1035061798 7:156074928-156074950 CCAGGCAACGTGGACTTTCCCCG No data
Right 1035061812 7:156074977-156074999 CAGCCCTGATGGAGGCGAAAGGG No data
1035061805_1035061812 6 Left 1035061805 7:156074948-156074970 CCGTGGTCCTCAATCAGTGGGGG No data
Right 1035061812 7:156074977-156074999 CAGCCCTGATGGAGGCGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035061812 Original CRISPR CAGCCCTGATGGAGGCGAAA GGG Intergenic
No off target data available for this crispr