ID: 1035061815

View in Genome Browser
Species Human (GRCh38)
Location 7:156074983-156075005
Sequence TGATGGAGGCGAAAGGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035061801_1035061815 14 Left 1035061801 7:156074946-156074968 CCCCGTGGTCCTCAATCAGTGGG No data
Right 1035061815 7:156074983-156075005 TGATGGAGGCGAAAGGGAGCAGG No data
1035061803_1035061815 13 Left 1035061803 7:156074947-156074969 CCCGTGGTCCTCAATCAGTGGGG No data
Right 1035061815 7:156074983-156075005 TGATGGAGGCGAAAGGGAGCAGG No data
1035061805_1035061815 12 Left 1035061805 7:156074948-156074970 CCGTGGTCCTCAATCAGTGGGGG No data
Right 1035061815 7:156074983-156075005 TGATGGAGGCGAAAGGGAGCAGG No data
1035061808_1035061815 5 Left 1035061808 7:156074955-156074977 CCTCAATCAGTGGGGGGAGTTTC No data
Right 1035061815 7:156074983-156075005 TGATGGAGGCGAAAGGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035061815 Original CRISPR TGATGGAGGCGAAAGGGAGC AGG Intergenic
No off target data available for this crispr