ID: 1035062788

View in Genome Browser
Species Human (GRCh38)
Location 7:156081524-156081546
Sequence GGGGGTAGTGCAGTGACTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035062780_1035062788 15 Left 1035062780 7:156081486-156081508 CCTAGATAGCAGGGACTGCACCC No data
Right 1035062788 7:156081524-156081546 GGGGGTAGTGCAGTGACTGCCGG No data
1035062784_1035062788 -5 Left 1035062784 7:156081506-156081528 CCCCACTCTTTGTACATTGGGGG No data
Right 1035062788 7:156081524-156081546 GGGGGTAGTGCAGTGACTGCCGG No data
1035062786_1035062788 -6 Left 1035062786 7:156081507-156081529 CCCACTCTTTGTACATTGGGGGT No data
Right 1035062788 7:156081524-156081546 GGGGGTAGTGCAGTGACTGCCGG No data
1035062787_1035062788 -7 Left 1035062787 7:156081508-156081530 CCACTCTTTGTACATTGGGGGTA No data
Right 1035062788 7:156081524-156081546 GGGGGTAGTGCAGTGACTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035062788 Original CRISPR GGGGGTAGTGCAGTGACTGC CGG Intergenic
No off target data available for this crispr