ID: 1035065771

View in Genome Browser
Species Human (GRCh38)
Location 7:156104219-156104241
Sequence AAGCTTGGCCAGGGCTTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035065766_1035065771 -10 Left 1035065766 7:156104206-156104228 CCACCGCAGCAGGAAGCTTGGCC No data
Right 1035065771 7:156104219-156104241 AAGCTTGGCCAGGGCTTTGAGGG No data
1035065755_1035065771 22 Left 1035065755 7:156104174-156104196 CCAGAGGACCAACCAGCCCCTTA No data
Right 1035065771 7:156104219-156104241 AAGCTTGGCCAGGGCTTTGAGGG No data
1035065757_1035065771 14 Left 1035065757 7:156104182-156104204 CCAACCAGCCCCTTACCCTGGCA No data
Right 1035065771 7:156104219-156104241 AAGCTTGGCCAGGGCTTTGAGGG No data
1035065759_1035065771 6 Left 1035065759 7:156104190-156104212 CCCCTTACCCTGGCATCCACCGC No data
Right 1035065771 7:156104219-156104241 AAGCTTGGCCAGGGCTTTGAGGG No data
1035065764_1035065771 -2 Left 1035065764 7:156104198-156104220 CCTGGCATCCACCGCAGCAGGAA No data
Right 1035065771 7:156104219-156104241 AAGCTTGGCCAGGGCTTTGAGGG No data
1035065763_1035065771 -1 Left 1035065763 7:156104197-156104219 CCCTGGCATCCACCGCAGCAGGA No data
Right 1035065771 7:156104219-156104241 AAGCTTGGCCAGGGCTTTGAGGG No data
1035065758_1035065771 10 Left 1035065758 7:156104186-156104208 CCAGCCCCTTACCCTGGCATCCA No data
Right 1035065771 7:156104219-156104241 AAGCTTGGCCAGGGCTTTGAGGG No data
1035065761_1035065771 4 Left 1035065761 7:156104192-156104214 CCTTACCCTGGCATCCACCGCAG No data
Right 1035065771 7:156104219-156104241 AAGCTTGGCCAGGGCTTTGAGGG No data
1035065760_1035065771 5 Left 1035065760 7:156104191-156104213 CCCTTACCCTGGCATCCACCGCA No data
Right 1035065771 7:156104219-156104241 AAGCTTGGCCAGGGCTTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035065771 Original CRISPR AAGCTTGGCCAGGGCTTTGA GGG Intergenic
No off target data available for this crispr