ID: 1035066343

View in Genome Browser
Species Human (GRCh38)
Location 7:156107937-156107959
Sequence AAGTGCCGCTGTGTGGCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035066337_1035066343 27 Left 1035066337 7:156107887-156107909 CCCGTGGGTTGGGGCTGGCTCTG No data
Right 1035066343 7:156107937-156107959 AAGTGCCGCTGTGTGGCTTCTGG No data
1035066336_1035066343 28 Left 1035066336 7:156107886-156107908 CCCCGTGGGTTGGGGCTGGCTCT No data
Right 1035066343 7:156107937-156107959 AAGTGCCGCTGTGTGGCTTCTGG No data
1035066338_1035066343 26 Left 1035066338 7:156107888-156107910 CCGTGGGTTGGGGCTGGCTCTGT No data
Right 1035066343 7:156107937-156107959 AAGTGCCGCTGTGTGGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035066343 Original CRISPR AAGTGCCGCTGTGTGGCTTC TGG Intergenic
No off target data available for this crispr