ID: 1035066413

View in Genome Browser
Species Human (GRCh38)
Location 7:156108433-156108455
Sequence CGTGGACCCCGGGGCGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035066413_1035066425 15 Left 1035066413 7:156108433-156108455 CCATCCCCGCCCCGGGGTCCACG No data
Right 1035066425 7:156108471-156108493 TTTTGACTCTCTCTCTTGGCAGG No data
1035066413_1035066424 11 Left 1035066413 7:156108433-156108455 CCATCCCCGCCCCGGGGTCCACG No data
Right 1035066424 7:156108467-156108489 TTGTTTTTGACTCTCTCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035066413 Original CRISPR CGTGGACCCCGGGGCGGGGA TGG (reversed) Intergenic
No off target data available for this crispr