ID: 1035067842

View in Genome Browser
Species Human (GRCh38)
Location 7:156121248-156121270
Sequence TGAGGGCTTCCTGCAGGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035067842_1035067857 23 Left 1035067842 7:156121248-156121270 CCCCATCCTGCAGGAAGCCCTCA No data
Right 1035067857 7:156121294-156121316 CAAGGAATGGTCGGGGGAGCCGG No data
1035067842_1035067849 5 Left 1035067842 7:156121248-156121270 CCCCATCCTGCAGGAAGCCCTCA No data
Right 1035067849 7:156121276-156121298 GCTGTGTGAAAGCCATGCCAAGG No data
1035067842_1035067853 16 Left 1035067842 7:156121248-156121270 CCCCATCCTGCAGGAAGCCCTCA No data
Right 1035067853 7:156121287-156121309 GCCATGCCAAGGAATGGTCGGGG No data
1035067842_1035067851 14 Left 1035067842 7:156121248-156121270 CCCCATCCTGCAGGAAGCCCTCA No data
Right 1035067851 7:156121285-156121307 AAGCCATGCCAAGGAATGGTCGG No data
1035067842_1035067852 15 Left 1035067842 7:156121248-156121270 CCCCATCCTGCAGGAAGCCCTCA No data
Right 1035067852 7:156121286-156121308 AGCCATGCCAAGGAATGGTCGGG No data
1035067842_1035067850 10 Left 1035067842 7:156121248-156121270 CCCCATCCTGCAGGAAGCCCTCA No data
Right 1035067850 7:156121281-156121303 GTGAAAGCCATGCCAAGGAATGG No data
1035067842_1035067855 17 Left 1035067842 7:156121248-156121270 CCCCATCCTGCAGGAAGCCCTCA No data
Right 1035067855 7:156121288-156121310 CCATGCCAAGGAATGGTCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035067842 Original CRISPR TGAGGGCTTCCTGCAGGATG GGG (reversed) Intergenic
No off target data available for this crispr