ID: 1035067852

View in Genome Browser
Species Human (GRCh38)
Location 7:156121286-156121308
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035067842_1035067852 15 Left 1035067842 7:156121248-156121270 CCCCATCCTGCAGGAAGCCCTCA No data
Right 1035067852 7:156121286-156121308 AGCCATGCCAAGGAATGGTCGGG No data
1035067846_1035067852 9 Left 1035067846 7:156121254-156121276 CCTGCAGGAAGCCCTCAGAGGCG No data
Right 1035067852 7:156121286-156121308 AGCCATGCCAAGGAATGGTCGGG No data
1035067847_1035067852 -2 Left 1035067847 7:156121265-156121287 CCCTCAGAGGCGCTGTGTGAAAG No data
Right 1035067852 7:156121286-156121308 AGCCATGCCAAGGAATGGTCGGG No data
1035067848_1035067852 -3 Left 1035067848 7:156121266-156121288 CCTCAGAGGCGCTGTGTGAAAGC No data
Right 1035067852 7:156121286-156121308 AGCCATGCCAAGGAATGGTCGGG No data
1035067844_1035067852 13 Left 1035067844 7:156121250-156121272 CCATCCTGCAGGAAGCCCTCAGA No data
Right 1035067852 7:156121286-156121308 AGCCATGCCAAGGAATGGTCGGG No data
1035067843_1035067852 14 Left 1035067843 7:156121249-156121271 CCCATCCTGCAGGAAGCCCTCAG No data
Right 1035067852 7:156121286-156121308 AGCCATGCCAAGGAATGGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035067852 Original CRISPR AGCCATGCCAAGGAATGGTC GGG Intergenic
No off target data available for this crispr