ID: 1035067958

View in Genome Browser
Species Human (GRCh38)
Location 7:156121769-156121791
Sequence AGCCACCCCGCTTGTGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035067951_1035067958 5 Left 1035067951 7:156121741-156121763 CCTGGGAAGTGCCTCCACCTGCA No data
Right 1035067958 7:156121769-156121791 AGCCACCCCGCTTGTGTGGTGGG No data
1035067950_1035067958 10 Left 1035067950 7:156121736-156121758 CCTCACCTGGGAAGTGCCTCCAC No data
Right 1035067958 7:156121769-156121791 AGCCACCCCGCTTGTGTGGTGGG No data
1035067945_1035067958 25 Left 1035067945 7:156121721-156121743 CCCTCTGTCCTGCAGCCTCACCT No data
Right 1035067958 7:156121769-156121791 AGCCACCCCGCTTGTGTGGTGGG No data
1035067946_1035067958 24 Left 1035067946 7:156121722-156121744 CCTCTGTCCTGCAGCCTCACCTG No data
Right 1035067958 7:156121769-156121791 AGCCACCCCGCTTGTGTGGTGGG No data
1035067953_1035067958 -6 Left 1035067953 7:156121752-156121774 CCTCCACCTGCAGCAGGAGCCAC No data
Right 1035067958 7:156121769-156121791 AGCCACCCCGCTTGTGTGGTGGG No data
1035067954_1035067958 -9 Left 1035067954 7:156121755-156121777 CCACCTGCAGCAGGAGCCACCCC No data
Right 1035067958 7:156121769-156121791 AGCCACCCCGCTTGTGTGGTGGG No data
1035067949_1035067958 17 Left 1035067949 7:156121729-156121751 CCTGCAGCCTCACCTGGGAAGTG No data
Right 1035067958 7:156121769-156121791 AGCCACCCCGCTTGTGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035067958 Original CRISPR AGCCACCCCGCTTGTGTGGT GGG Intergenic
No off target data available for this crispr