ID: 1035068272

View in Genome Browser
Species Human (GRCh38)
Location 7:156123371-156123393
Sequence AGGGAGATGGCGGGTCCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035068272_1035068281 2 Left 1035068272 7:156123371-156123393 CCAGAAGGACCCGCCATCTCCCT No data
Right 1035068281 7:156123396-156123418 GCCTCCCAGGAGTGGTACTGTGG No data
1035068272_1035068287 27 Left 1035068272 7:156123371-156123393 CCAGAAGGACCCGCCATCTCCCT No data
Right 1035068287 7:156123421-156123443 ACTGACGGCCTCAGGAGCCATGG No data
1035068272_1035068286 19 Left 1035068272 7:156123371-156123393 CCAGAAGGACCCGCCATCTCCCT No data
Right 1035068286 7:156123413-156123435 CTGTGGAAACTGACGGCCTCAGG No data
1035068272_1035068277 -6 Left 1035068272 7:156123371-156123393 CCAGAAGGACCCGCCATCTCCCT No data
Right 1035068277 7:156123388-156123410 CTCCCTCCGCCTCCCAGGAGTGG No data
1035068272_1035068285 12 Left 1035068272 7:156123371-156123393 CCAGAAGGACCCGCCATCTCCCT No data
Right 1035068285 7:156123406-156123428 AGTGGTACTGTGGAAACTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035068272 Original CRISPR AGGGAGATGGCGGGTCCTTC TGG (reversed) Intergenic
No off target data available for this crispr