ID: 1035068281

View in Genome Browser
Species Human (GRCh38)
Location 7:156123396-156123418
Sequence GCCTCCCAGGAGTGGTACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035068273_1035068281 -7 Left 1035068273 7:156123380-156123402 CCCGCCATCTCCCTCCGCCTCCC No data
Right 1035068281 7:156123396-156123418 GCCTCCCAGGAGTGGTACTGTGG No data
1035068270_1035068281 4 Left 1035068270 7:156123369-156123391 CCCCAGAAGGACCCGCCATCTCC No data
Right 1035068281 7:156123396-156123418 GCCTCCCAGGAGTGGTACTGTGG No data
1035068269_1035068281 7 Left 1035068269 7:156123366-156123388 CCACCCCAGAAGGACCCGCCATC No data
Right 1035068281 7:156123396-156123418 GCCTCCCAGGAGTGGTACTGTGG No data
1035068271_1035068281 3 Left 1035068271 7:156123370-156123392 CCCAGAAGGACCCGCCATCTCCC No data
Right 1035068281 7:156123396-156123418 GCCTCCCAGGAGTGGTACTGTGG No data
1035068274_1035068281 -8 Left 1035068274 7:156123381-156123403 CCGCCATCTCCCTCCGCCTCCCA No data
Right 1035068281 7:156123396-156123418 GCCTCCCAGGAGTGGTACTGTGG No data
1035068272_1035068281 2 Left 1035068272 7:156123371-156123393 CCAGAAGGACCCGCCATCTCCCT No data
Right 1035068281 7:156123396-156123418 GCCTCCCAGGAGTGGTACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035068281 Original CRISPR GCCTCCCAGGAGTGGTACTG TGG Intergenic
No off target data available for this crispr