ID: 1035068287

View in Genome Browser
Species Human (GRCh38)
Location 7:156123421-156123443
Sequence ACTGACGGCCTCAGGAGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035068274_1035068287 17 Left 1035068274 7:156123381-156123403 CCGCCATCTCCCTCCGCCTCCCA No data
Right 1035068287 7:156123421-156123443 ACTGACGGCCTCAGGAGCCATGG No data
1035068284_1035068287 -3 Left 1035068284 7:156123401-156123423 CCAGGAGTGGTACTGTGGAAACT No data
Right 1035068287 7:156123421-156123443 ACTGACGGCCTCAGGAGCCATGG No data
1035068272_1035068287 27 Left 1035068272 7:156123371-156123393 CCAGAAGGACCCGCCATCTCCCT No data
Right 1035068287 7:156123421-156123443 ACTGACGGCCTCAGGAGCCATGG No data
1035068282_1035068287 1 Left 1035068282 7:156123397-156123419 CCTCCCAGGAGTGGTACTGTGGA No data
Right 1035068287 7:156123421-156123443 ACTGACGGCCTCAGGAGCCATGG No data
1035068278_1035068287 8 Left 1035068278 7:156123390-156123412 CCCTCCGCCTCCCAGGAGTGGTA No data
Right 1035068287 7:156123421-156123443 ACTGACGGCCTCAGGAGCCATGG No data
1035068271_1035068287 28 Left 1035068271 7:156123370-156123392 CCCAGAAGGACCCGCCATCTCCC No data
Right 1035068287 7:156123421-156123443 ACTGACGGCCTCAGGAGCCATGG No data
1035068279_1035068287 7 Left 1035068279 7:156123391-156123413 CCTCCGCCTCCCAGGAGTGGTAC No data
Right 1035068287 7:156123421-156123443 ACTGACGGCCTCAGGAGCCATGG No data
1035068280_1035068287 4 Left 1035068280 7:156123394-156123416 CCGCCTCCCAGGAGTGGTACTGT No data
Right 1035068287 7:156123421-156123443 ACTGACGGCCTCAGGAGCCATGG No data
1035068273_1035068287 18 Left 1035068273 7:156123380-156123402 CCCGCCATCTCCCTCCGCCTCCC No data
Right 1035068287 7:156123421-156123443 ACTGACGGCCTCAGGAGCCATGG No data
1035068283_1035068287 -2 Left 1035068283 7:156123400-156123422 CCCAGGAGTGGTACTGTGGAAAC No data
Right 1035068287 7:156123421-156123443 ACTGACGGCCTCAGGAGCCATGG No data
1035068270_1035068287 29 Left 1035068270 7:156123369-156123391 CCCCAGAAGGACCCGCCATCTCC No data
Right 1035068287 7:156123421-156123443 ACTGACGGCCTCAGGAGCCATGG No data
1035068276_1035068287 14 Left 1035068276 7:156123384-156123406 CCATCTCCCTCCGCCTCCCAGGA No data
Right 1035068287 7:156123421-156123443 ACTGACGGCCTCAGGAGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035068287 Original CRISPR ACTGACGGCCTCAGGAGCCA TGG Intergenic
No off target data available for this crispr