ID: 1035069080

View in Genome Browser
Species Human (GRCh38)
Location 7:156127722-156127744
Sequence GAACAGGAGGACAACGGGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035069074_1035069080 11 Left 1035069074 7:156127688-156127710 CCGAAGGAAAACACGATGGAAGT No data
Right 1035069080 7:156127722-156127744 GAACAGGAGGACAACGGGCTCGG No data
1035069068_1035069080 19 Left 1035069068 7:156127680-156127702 CCAACCCCCCGAAGGAAAACACG No data
Right 1035069080 7:156127722-156127744 GAACAGGAGGACAACGGGCTCGG No data
1035069066_1035069080 29 Left 1035069066 7:156127670-156127692 CCTGGGGTAGCCAACCCCCCGAA No data
Right 1035069080 7:156127722-156127744 GAACAGGAGGACAACGGGCTCGG No data
1035069073_1035069080 12 Left 1035069073 7:156127687-156127709 CCCGAAGGAAAACACGATGGAAG No data
Right 1035069080 7:156127722-156127744 GAACAGGAGGACAACGGGCTCGG No data
1035069071_1035069080 14 Left 1035069071 7:156127685-156127707 CCCCCGAAGGAAAACACGATGGA No data
Right 1035069080 7:156127722-156127744 GAACAGGAGGACAACGGGCTCGG No data
1035069072_1035069080 13 Left 1035069072 7:156127686-156127708 CCCCGAAGGAAAACACGATGGAA No data
Right 1035069080 7:156127722-156127744 GAACAGGAGGACAACGGGCTCGG No data
1035069069_1035069080 15 Left 1035069069 7:156127684-156127706 CCCCCCGAAGGAAAACACGATGG No data
Right 1035069080 7:156127722-156127744 GAACAGGAGGACAACGGGCTCGG No data
1035069065_1035069080 30 Left 1035069065 7:156127669-156127691 CCCTGGGGTAGCCAACCCCCCGA No data
Right 1035069080 7:156127722-156127744 GAACAGGAGGACAACGGGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035069080 Original CRISPR GAACAGGAGGACAACGGGCT CGG Intergenic
No off target data available for this crispr