ID: 1035070413

View in Genome Browser
Species Human (GRCh38)
Location 7:156140568-156140590
Sequence CAGAGAGAGGAGAAAGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035070409_1035070413 -4 Left 1035070409 7:156140549-156140571 CCCAGAGACAGGGGCAAGACAGA No data
Right 1035070413 7:156140568-156140590 CAGAGAGAGGAGAAAGAGGCAGG No data
1035070410_1035070413 -5 Left 1035070410 7:156140550-156140572 CCAGAGACAGGGGCAAGACAGAG No data
Right 1035070413 7:156140568-156140590 CAGAGAGAGGAGAAAGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035070413 Original CRISPR CAGAGAGAGGAGAAAGAGGC AGG Intergenic
No off target data available for this crispr