ID: 1035074361

View in Genome Browser
Species Human (GRCh38)
Location 7:156168753-156168775
Sequence GCTTGTCTGCAGAGGGCAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035074355_1035074361 5 Left 1035074355 7:156168725-156168747 CCCTGGTGGGCAGAGAACACGTT No data
Right 1035074361 7:156168753-156168775 GCTTGTCTGCAGAGGGCAGCGGG No data
1035074356_1035074361 4 Left 1035074356 7:156168726-156168748 CCTGGTGGGCAGAGAACACGTTT No data
Right 1035074361 7:156168753-156168775 GCTTGTCTGCAGAGGGCAGCGGG No data
1035074354_1035074361 13 Left 1035074354 7:156168717-156168739 CCGGGGTGCCCTGGTGGGCAGAG No data
Right 1035074361 7:156168753-156168775 GCTTGTCTGCAGAGGGCAGCGGG No data
1035074351_1035074361 19 Left 1035074351 7:156168711-156168733 CCAAATCCGGGGTGCCCTGGTGG No data
Right 1035074361 7:156168753-156168775 GCTTGTCTGCAGAGGGCAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035074361 Original CRISPR GCTTGTCTGCAGAGGGCAGC GGG Intergenic
No off target data available for this crispr