ID: 1035076512

View in Genome Browser
Species Human (GRCh38)
Location 7:156181101-156181123
Sequence CAGAGCAAGGAGCTGGCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035076512_1035076519 19 Left 1035076512 7:156181101-156181123 CCCGCGGCCAGCTCCTTGCTCTG No data
Right 1035076519 7:156181143-156181165 CTGCAGCCAGCTCCTTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035076512 Original CRISPR CAGAGCAAGGAGCTGGCCGC GGG (reversed) Intergenic
No off target data available for this crispr