ID: 1035076518

View in Genome Browser
Species Human (GRCh38)
Location 7:156181142-156181164
Sequence CAGAGCAAGGAGCTGGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035076518_1035076523 18 Left 1035076518 7:156181142-156181164 CCTGCAGCCAGCTCCTTGCTCTG No data
Right 1035076523 7:156181183-156181205 ATGAGACTGACTCCTGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035076518 Original CRISPR CAGAGCAAGGAGCTGGCTGC AGG (reversed) Intergenic
No off target data available for this crispr